ctni primary antibody 1ab stock solution Search Results


90
Becton Dickinson pu.1 ab
Pu.1 Ab, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ctni+primary+antibody+1ab+stock+solution/g148+74+antibody/10__1038_slash_labinvest__2010__21-2500-5-10
Average 90 stars, based on 1 article reviews
pu.1 ab - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Becton Dickinson monoclonal anti-hif-1 ab
Monoclonal Anti Hif 1 Ab, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ctni+primary+antibody+1ab+stock+solution/hif+1%CE%B1+antibody/pm20491781-38-33-37
Average 90 stars, based on 1 article reviews
monoclonal anti-hif-1 ab - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Oncogene Science Inc antibodies specific brca1 (ab-1, ab-2
DNA damage-induced phosphorylation of <t>BRCA1</t> on Ser 1423. (A) Endogenous BRCA1 is phosphorylated at Ser 1423 in intact cells. HEK 293T cells were either left untreated or cultured for 1 h following cellular exposure to IR (25 Gy), UV light (50 J/m2) or HU (2 mM). Cellular lysates were prepared and analyzed by immunoblot analysis using α-BRCA1 and α-pS-1423 antibodies. Cell lysates were treated with λ phosphatase where indicated. The relative levels of Ser 1423 phosphorylation were determined by densitometric analysis of the α-pS-1423 immunoblot and are presented at bottom. Values were normalized to the total level of BRCA1 present in each lane. (B) Phosphorylation of BRCA1 on Ser 1423 in A-T cells. ATM-deficient AT22IJE-T cells that had been stably transfected with empty expression vector (ATM−) or wild-type ATM (ATM+) were left untreated or exposed to IR (10, 25, or 50 Gy), UV light (50 J/m2), or HU (2 mM) and harvested 1 h later. Cell lysates were analyzed by SDS-PAGE and immunoblot analysis with the α-pS-1423 antibody to detect Ser 1423-phosphorylated BRCA1. Total levels of BRCA1 were then determined by reblotting the stripped membrane with an α-BRCA1 mAb. Densitometry was performed on the α-pS-1423 and α-BRCA1 immunoblots and the α-pS-1423/α-BRCA1 density ratios were used to calculate normalized levels of Ser 1423 phosphorylation, which are plotted as histograms at bottom. (C) Comparison of the time courses of IR-induced Ser 1423 phosphorylation in ATM− and ATM+ AT22IJE-T cells. Cells were harvested at the indicated times following exposure to 25 Gy of IR and subjected to immunoblot analysis using α-pS-1423 and α-BRCA1 antibodies as described in B. Levels of normalized Ser 1423 phosphorylation are presented at bottom.
Antibodies Specific Brca1 (Ab 1, Ab 2, supplied by Oncogene Science Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ctni+primary+antibody+1ab+stock+solution/anti+brca2/pmc00317107-520-6-12
Average 90 stars, based on 1 article reviews
antibodies specific brca1 (ab-1, ab-2 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

92
Revvity mouse igg 1 anti pd 1 ab
DNA damage-induced phosphorylation of <t>BRCA1</t> on Ser 1423. (A) Endogenous BRCA1 is phosphorylated at Ser 1423 in intact cells. HEK 293T cells were either left untreated or cultured for 1 h following cellular exposure to IR (25 Gy), UV light (50 J/m2) or HU (2 mM). Cellular lysates were prepared and analyzed by immunoblot analysis using α-BRCA1 and α-pS-1423 antibodies. Cell lysates were treated with λ phosphatase where indicated. The relative levels of Ser 1423 phosphorylation were determined by densitometric analysis of the α-pS-1423 immunoblot and are presented at bottom. Values were normalized to the total level of BRCA1 present in each lane. (B) Phosphorylation of BRCA1 on Ser 1423 in A-T cells. ATM-deficient AT22IJE-T cells that had been stably transfected with empty expression vector (ATM−) or wild-type ATM (ATM+) were left untreated or exposed to IR (10, 25, or 50 Gy), UV light (50 J/m2), or HU (2 mM) and harvested 1 h later. Cell lysates were analyzed by SDS-PAGE and immunoblot analysis with the α-pS-1423 antibody to detect Ser 1423-phosphorylated BRCA1. Total levels of BRCA1 were then determined by reblotting the stripped membrane with an α-BRCA1 mAb. Densitometry was performed on the α-pS-1423 and α-BRCA1 immunoblots and the α-pS-1423/α-BRCA1 density ratios were used to calculate normalized levels of Ser 1423 phosphorylation, which are plotted as histograms at bottom. (C) Comparison of the time courses of IR-induced Ser 1423 phosphorylation in ATM− and ATM+ AT22IJE-T cells. Cells were harvested at the indicated times following exposure to 25 Gy of IR and subjected to immunoblot analysis using α-pS-1423 and α-BRCA1 antibodies as described in B. Levels of normalized Ser 1423 phosphorylation are presented at bottom.
Mouse Igg 1 Anti Pd 1 Ab, supplied by Revvity, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ctni+primary+antibody+1ab+stock+solution/Anti-Mouse+IgG+(Goat)%2C+AP+Conjugate/pmc03578953-58-20-25
Average 92 stars, based on 1 article reviews
mouse igg 1 anti pd 1 ab - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

96
Thermo Fisher gene exp cxcl1 rn00578225 m1
DNA damage-induced phosphorylation of <t>BRCA1</t> on Ser 1423. (A) Endogenous BRCA1 is phosphorylated at Ser 1423 in intact cells. HEK 293T cells were either left untreated or cultured for 1 h following cellular exposure to IR (25 Gy), UV light (50 J/m2) or HU (2 mM). Cellular lysates were prepared and analyzed by immunoblot analysis using α-BRCA1 and α-pS-1423 antibodies. Cell lysates were treated with λ phosphatase where indicated. The relative levels of Ser 1423 phosphorylation were determined by densitometric analysis of the α-pS-1423 immunoblot and are presented at bottom. Values were normalized to the total level of BRCA1 present in each lane. (B) Phosphorylation of BRCA1 on Ser 1423 in A-T cells. ATM-deficient AT22IJE-T cells that had been stably transfected with empty expression vector (ATM−) or wild-type ATM (ATM+) were left untreated or exposed to IR (10, 25, or 50 Gy), UV light (50 J/m2), or HU (2 mM) and harvested 1 h later. Cell lysates were analyzed by SDS-PAGE and immunoblot analysis with the α-pS-1423 antibody to detect Ser 1423-phosphorylated BRCA1. Total levels of BRCA1 were then determined by reblotting the stripped membrane with an α-BRCA1 mAb. Densitometry was performed on the α-pS-1423 and α-BRCA1 immunoblots and the α-pS-1423/α-BRCA1 density ratios were used to calculate normalized levels of Ser 1423 phosphorylation, which are plotted as histograms at bottom. (C) Comparison of the time courses of IR-induced Ser 1423 phosphorylation in ATM− and ATM+ AT22IJE-T cells. Cells were harvested at the indicated times following exposure to 25 Gy of IR and subjected to immunoblot analysis using α-pS-1423 and α-BRCA1 antibodies as described in B. Levels of normalized Ser 1423 phosphorylation are presented at bottom.
Gene Exp Cxcl1 Rn00578225 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ctni+primary+antibody+1ab+stock+solution/Gene+Exp%2E+Cxcl1%2C+Rn00578225_m1/10__1097_slash_tp__0000000000000577-77-86-68
Average 96 stars, based on 1 article reviews
gene exp cxcl1 rn00578225 m1 - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

86
Merck & Co kháng thể đơn dòng kháng pd 1
DNA damage-induced phosphorylation of <t>BRCA1</t> on Ser 1423. (A) Endogenous BRCA1 is phosphorylated at Ser 1423 in intact cells. HEK 293T cells were either left untreated or cultured for 1 h following cellular exposure to IR (25 Gy), UV light (50 J/m2) or HU (2 mM). Cellular lysates were prepared and analyzed by immunoblot analysis using α-BRCA1 and α-pS-1423 antibodies. Cell lysates were treated with λ phosphatase where indicated. The relative levels of Ser 1423 phosphorylation were determined by densitometric analysis of the α-pS-1423 immunoblot and are presented at bottom. Values were normalized to the total level of BRCA1 present in each lane. (B) Phosphorylation of BRCA1 on Ser 1423 in A-T cells. ATM-deficient AT22IJE-T cells that had been stably transfected with empty expression vector (ATM−) or wild-type ATM (ATM+) were left untreated or exposed to IR (10, 25, or 50 Gy), UV light (50 J/m2), or HU (2 mM) and harvested 1 h later. Cell lysates were analyzed by SDS-PAGE and immunoblot analysis with the α-pS-1423 antibody to detect Ser 1423-phosphorylated BRCA1. Total levels of BRCA1 were then determined by reblotting the stripped membrane with an α-BRCA1 mAb. Densitometry was performed on the α-pS-1423 and α-BRCA1 immunoblots and the α-pS-1423/α-BRCA1 density ratios were used to calculate normalized levels of Ser 1423 phosphorylation, which are plotted as histograms at bottom. (C) Comparison of the time courses of IR-induced Ser 1423 phosphorylation in ATM− and ATM+ AT22IJE-T cells. Cells were harvested at the indicated times following exposure to 25 Gy of IR and subjected to immunoblot analysis using α-pS-1423 and α-BRCA1 antibodies as described in B. Levels of normalized Ser 1423 phosphorylation are presented at bottom.
Kháng Thể đơn Dòng Kháng Pd 1, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ctni+primary+antibody+1ab+stock+solution/2+cov+c%C3%B3+c%E1%BB%A7a+d%E1%BA%ABn+kh%C3%A1ng+kh%E1%BA%A3+l%C3%A0+molnupiravir+n4hydroxycytidin+n%C4%83ng+ribonucleosid+sars+xu%E1%BA%A5t/10__34238_slash_tnu___jst__10280-48-1-15
Average 86 stars, based on 1 article reviews
kháng thể đơn dòng kháng pd 1 - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

90
Becton Dickinson anti-cd45.1 ab-percp-cy5.5

Anti Cd45.1 Ab Percp Cy5.5, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ctni+primary+antibody+1ab+stock+solution/anti+cd3/pmc08426562-306-10-14
Average 90 stars, based on 1 article reviews
anti-cd45.1 ab-percp-cy5.5 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

99
Integrated DNA Technologies aagtgaacgacatctcatct

Aagtgaacgacatctcatct, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ctni+primary+antibody+1ab+stock+solution/Cas9+Nuclease/bio_rxiv__470013-36-23-24
Average 99 stars, based on 1 article reviews
aagtgaacgacatctcatct - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

90
AB Biodisk North American Inc etest

Etest, supplied by AB Biodisk North American Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ctni+primary+antibody+1ab+stock+solution/etest/pm11751789-8-37-9
Average 90 stars, based on 1 article reviews
etest - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Oncogene Science Inc rat monoclonal antibody ab-1

Rat Monoclonal Antibody Ab 1, supplied by Oncogene Science Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ctni+primary+antibody+1ab+stock+solution/rat+monoclonal+antibody/pm11032025-167-4-5
Average 90 stars, based on 1 article reviews
rat monoclonal antibody ab-1 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

95
Santa Cruz Biotechnology flotillin 1 ab

Flotillin 1 Ab, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ctni+primary+antibody+1ab+stock+solution/Flotillin-1+Antibody/pmc03044964-354-36-45
Average 95 stars, based on 1 article reviews
flotillin 1 ab - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

96
Santa Cruz Biotechnology rabbit anti c jun n terminal kinase jnk 1 ab

Rabbit Anti C Jun N Terminal Kinase Jnk 1 Ab, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ctni+primary+antibody+1ab+stock+solution/JNK+Antibody/pm11313410-60-27-33
Average 96 stars, based on 1 article reviews
rabbit anti c jun n terminal kinase jnk 1 ab - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

Image Search Results


DNA damage-induced phosphorylation of BRCA1 on Ser 1423. (A) Endogenous BRCA1 is phosphorylated at Ser 1423 in intact cells. HEK 293T cells were either left untreated or cultured for 1 h following cellular exposure to IR (25 Gy), UV light (50 J/m2) or HU (2 mM). Cellular lysates were prepared and analyzed by immunoblot analysis using α-BRCA1 and α-pS-1423 antibodies. Cell lysates were treated with λ phosphatase where indicated. The relative levels of Ser 1423 phosphorylation were determined by densitometric analysis of the α-pS-1423 immunoblot and are presented at bottom. Values were normalized to the total level of BRCA1 present in each lane. (B) Phosphorylation of BRCA1 on Ser 1423 in A-T cells. ATM-deficient AT22IJE-T cells that had been stably transfected with empty expression vector (ATM−) or wild-type ATM (ATM+) were left untreated or exposed to IR (10, 25, or 50 Gy), UV light (50 J/m2), or HU (2 mM) and harvested 1 h later. Cell lysates were analyzed by SDS-PAGE and immunoblot analysis with the α-pS-1423 antibody to detect Ser 1423-phosphorylated BRCA1. Total levels of BRCA1 were then determined by reblotting the stripped membrane with an α-BRCA1 mAb. Densitometry was performed on the α-pS-1423 and α-BRCA1 immunoblots and the α-pS-1423/α-BRCA1 density ratios were used to calculate normalized levels of Ser 1423 phosphorylation, which are plotted as histograms at bottom. (C) Comparison of the time courses of IR-induced Ser 1423 phosphorylation in ATM− and ATM+ AT22IJE-T cells. Cells were harvested at the indicated times following exposure to 25 Gy of IR and subjected to immunoblot analysis using α-pS-1423 and α-BRCA1 antibodies as described in B. Levels of normalized Ser 1423 phosphorylation are presented at bottom.

Journal:

Article Title: Functional interactions between BRCA1 and the checkpoint kinase ATR during genotoxic stress

doi:

Figure Lengend Snippet: DNA damage-induced phosphorylation of BRCA1 on Ser 1423. (A) Endogenous BRCA1 is phosphorylated at Ser 1423 in intact cells. HEK 293T cells were either left untreated or cultured for 1 h following cellular exposure to IR (25 Gy), UV light (50 J/m2) or HU (2 mM). Cellular lysates were prepared and analyzed by immunoblot analysis using α-BRCA1 and α-pS-1423 antibodies. Cell lysates were treated with λ phosphatase where indicated. The relative levels of Ser 1423 phosphorylation were determined by densitometric analysis of the α-pS-1423 immunoblot and are presented at bottom. Values were normalized to the total level of BRCA1 present in each lane. (B) Phosphorylation of BRCA1 on Ser 1423 in A-T cells. ATM-deficient AT22IJE-T cells that had been stably transfected with empty expression vector (ATM−) or wild-type ATM (ATM+) were left untreated or exposed to IR (10, 25, or 50 Gy), UV light (50 J/m2), or HU (2 mM) and harvested 1 h later. Cell lysates were analyzed by SDS-PAGE and immunoblot analysis with the α-pS-1423 antibody to detect Ser 1423-phosphorylated BRCA1. Total levels of BRCA1 were then determined by reblotting the stripped membrane with an α-BRCA1 mAb. Densitometry was performed on the α-pS-1423 and α-BRCA1 immunoblots and the α-pS-1423/α-BRCA1 density ratios were used to calculate normalized levels of Ser 1423 phosphorylation, which are plotted as histograms at bottom. (C) Comparison of the time courses of IR-induced Ser 1423 phosphorylation in ATM− and ATM+ AT22IJE-T cells. Cells were harvested at the indicated times following exposure to 25 Gy of IR and subjected to immunoblot analysis using α-pS-1423 and α-BRCA1 antibodies as described in B. Levels of normalized Ser 1423 phosphorylation are presented at bottom.

Article Snippet: Antibodies specific for ATR (Ab-1) and BRCA1 (Ab-1, Ab-2) were purchased from Oncogene Science.

Techniques: Cell Culture, Western Blot, Stable Transfection, Transfection, Expressing, Plasmid Preparation, SDS Page

ATR phosphorylates BRCA1 in vitro. (A) Schematic depiction of the six GST–BRCA1 fusion proteins tested as ATR substrates in immune complex kinase assays. SCD designates the S-Q cluster domain. (B) Phosphorylation of GST–BRCA1 fusion proteins requires a functional ATR kinase domain. HEK 293T cells were transiently transfected with either pcDNA3 (−), or plasmid constructs encoding FLAG-tagged wild-type ATR (WT), or FLAG-tagged catalytically-inactive ATR (KI). Cellular extracts were immunoprecipitated with α-FLAG mAb, and immune complex kinase assays were performed with GST–BRCA1 (1005–1313) or GST–BRCA1 (1314–1863) as the substrates. The levels of phosphorylated fusion protein and FLAG–ATR expression are presented at top and bottom, respectively. The other four GST–BRCA1 substrates depicted in A, were not phosphorylated by ATR above background levels (not shown). (C) Identification of ATR phosphorylation sites in GST–BRCA1 (1005–1313). ATR immune complex kinase assays were performed using cell lysates prepared from HEK 293T cells that had been transfected with either pcDNA3 (−) or FLAG–ATRWT (+). Wild-type (WT) or mutant GST–BRCA1 (1005–1313) fusion proteins containing either single or combination Ala substitutions at the indicated residues were used as substrates. (D) Identification of ATR phosphorylation sites in GST–BRCA1 (1314–1863). Wild-type (WT) or mutant GST–BRCA1 (1314–1863) fusion proteins containing single Ala substitutions at the indicated residues, or a GST–BRCA1 (1314–1863) mutant protein (4A) containing Ala substitutions at Ser 1387, Thr 1394, Ser 1423, and Ser 1457, were used as substrates in ATR kinase assays. Each panel represents a single experiment that is representative of the results obtained in independent trials.

Journal:

Article Title: Functional interactions between BRCA1 and the checkpoint kinase ATR during genotoxic stress

doi:

Figure Lengend Snippet: ATR phosphorylates BRCA1 in vitro. (A) Schematic depiction of the six GST–BRCA1 fusion proteins tested as ATR substrates in immune complex kinase assays. SCD designates the S-Q cluster domain. (B) Phosphorylation of GST–BRCA1 fusion proteins requires a functional ATR kinase domain. HEK 293T cells were transiently transfected with either pcDNA3 (−), or plasmid constructs encoding FLAG-tagged wild-type ATR (WT), or FLAG-tagged catalytically-inactive ATR (KI). Cellular extracts were immunoprecipitated with α-FLAG mAb, and immune complex kinase assays were performed with GST–BRCA1 (1005–1313) or GST–BRCA1 (1314–1863) as the substrates. The levels of phosphorylated fusion protein and FLAG–ATR expression are presented at top and bottom, respectively. The other four GST–BRCA1 substrates depicted in A, were not phosphorylated by ATR above background levels (not shown). (C) Identification of ATR phosphorylation sites in GST–BRCA1 (1005–1313). ATR immune complex kinase assays were performed using cell lysates prepared from HEK 293T cells that had been transfected with either pcDNA3 (−) or FLAG–ATRWT (+). Wild-type (WT) or mutant GST–BRCA1 (1005–1313) fusion proteins containing either single or combination Ala substitutions at the indicated residues were used as substrates. (D) Identification of ATR phosphorylation sites in GST–BRCA1 (1314–1863). Wild-type (WT) or mutant GST–BRCA1 (1314–1863) fusion proteins containing single Ala substitutions at the indicated residues, or a GST–BRCA1 (1314–1863) mutant protein (4A) containing Ala substitutions at Ser 1387, Thr 1394, Ser 1423, and Ser 1457, were used as substrates in ATR kinase assays. Each panel represents a single experiment that is representative of the results obtained in independent trials.

Article Snippet: Antibodies specific for ATR (Ab-1) and BRCA1 (Ab-1, Ab-2) were purchased from Oncogene Science.

Techniques: In Vitro, Immune Complex Kinase Assay, Functional Assay, Transfection, Plasmid Preparation, Construct, Immunoprecipitation, Expressing, Mutagenesis

Overexpression of kinase-inactive ATR inhibits BRCA1 phosphorylation. (A) HEK 293T cells were cotransfected with expression constructs encoding BRCA1-HA and either pcDNA3, wild-type ATR (WT) or kinase-inactive (KI). Cells were then cultured in the absence or presence of 5 μg/ml APH for 24 h. BRCA1-HA was immunoprecipitated from cell lysates and analyzed by SDS-PAGE and immunoblotting with α-HA. Levels of ATR overexpression were determined by α-ATR immunoblot. (B) BRCA1 is modified at one or more ATR phosphorylation sites in intact cells. (top) HEK 293T cells were transfected with an expression construct encoding an amino-terminally-truncated BRCA1 construct (AU1-BRCA1–ΔN) spanning BRCA1 amino acids 1317–1863 (see Materials and Methods). Cells were left untreated or cultured for 4 h in the presence of 5 μg/ml APH. Cell extracts were prepared and analyzed by SDS-PAGE and immunoblotting with α-AU1. Where indicated, cell lysates were treated with 400 units of λ phosphatase. The positions of α- β-, and γ-phosphorylated forms of AU1-BRCA1–ΔN are marked. (middle, bottom) HEK 293T cells were transfected with expression constructs encoding wild-type AU1-BRCA1–ΔN (WT), AU1-BRCA1–ΔN containing Ala substitutions at Ser 1387, Thr 1394, Ser 1423, and Ser 1457 (4A), or AU1-BRCA1–ΔN containing a single Ser 1423→Ala substitution (1423A). Transfected cells were then cultured for 4 h in the absence or presence of 5 μg/ml APH. Cell extracts were prepared and analyzed by SDS-PAGE and immunoblotting with α-AU1 (middle) or α-pS-1423 (bottom).

Journal:

Article Title: Functional interactions between BRCA1 and the checkpoint kinase ATR during genotoxic stress

doi:

Figure Lengend Snippet: Overexpression of kinase-inactive ATR inhibits BRCA1 phosphorylation. (A) HEK 293T cells were cotransfected with expression constructs encoding BRCA1-HA and either pcDNA3, wild-type ATR (WT) or kinase-inactive (KI). Cells were then cultured in the absence or presence of 5 μg/ml APH for 24 h. BRCA1-HA was immunoprecipitated from cell lysates and analyzed by SDS-PAGE and immunoblotting with α-HA. Levels of ATR overexpression were determined by α-ATR immunoblot. (B) BRCA1 is modified at one or more ATR phosphorylation sites in intact cells. (top) HEK 293T cells were transfected with an expression construct encoding an amino-terminally-truncated BRCA1 construct (AU1-BRCA1–ΔN) spanning BRCA1 amino acids 1317–1863 (see Materials and Methods). Cells were left untreated or cultured for 4 h in the presence of 5 μg/ml APH. Cell extracts were prepared and analyzed by SDS-PAGE and immunoblotting with α-AU1. Where indicated, cell lysates were treated with 400 units of λ phosphatase. The positions of α- β-, and γ-phosphorylated forms of AU1-BRCA1–ΔN are marked. (middle, bottom) HEK 293T cells were transfected with expression constructs encoding wild-type AU1-BRCA1–ΔN (WT), AU1-BRCA1–ΔN containing Ala substitutions at Ser 1387, Thr 1394, Ser 1423, and Ser 1457 (4A), or AU1-BRCA1–ΔN containing a single Ser 1423→Ala substitution (1423A). Transfected cells were then cultured for 4 h in the absence or presence of 5 μg/ml APH. Cell extracts were prepared and analyzed by SDS-PAGE and immunoblotting with α-AU1 (middle) or α-pS-1423 (bottom).

Article Snippet: Antibodies specific for ATR (Ab-1) and BRCA1 (Ab-1, Ab-2) were purchased from Oncogene Science.

Techniques: Over Expression, Expressing, Construct, Cell Culture, Immunoprecipitation, SDS Page, Western Blot, Modification, Transfection

Overexpression of wild-type ATR potentiates the phosphorylation of BRCA1 at Ser 1423 in intact cells. (A) Overexpression of FLAG–ATRWT stimulates the HU-induced phosphorylation of Ser 1423 in HEK 293T cells. HEK 293T cells were transfected with an expression vector encoding AU1-BRCA1–ΔN together with empty expression vector (−) or plasmids encoding FLAG–ATRWT, or FLAG–ATRKI. After 24 h, the transfected cells were left untreated or exposed to 2 mM HU, and harvested 1 h later. Cellular extracts were separated by SDS-PAGE and subjected to immunoblot analysis with the α-pS-1423 antibody to detect Ser 1423-phosphorylated BRCA1. Immunoblotting with α-FLAG or α-AU1 antibodies was performed to monitor expression levels of the FLAG–ATR and AU1-BRCA1–ΔN constructs, respectively. α-, β-, and γ-phosphorylated forms of AU1-BRCA1–ΔN are marked. (B) Overexpression of FLAG–ATRWT stimulates UV light-induced phosphorylation of Ser 1423 in HEK 293T cells. The experiment was performed as described in A, except that the transfected HEK 293T cells were exposed to 50 J/m2 UV light, and then harvested 1 h later. Cell lysates were subjected to SDS-PAGE and immunoblot analysis with the indicated antibodies. (C) Relative contributions of ATM and ATR to the IR-induced phosphorylation of BRCA1 on Ser 1423. HEK 293T cells were cotransfected with expression plasmids encoding FLAG-tagged BRCA1 (1351–1552) together with an empty expression vector (−), FLAG–ATR, or FLAG–ATM plasmids. The FLAG–ATR and FLAG–ATM expression constructs encoded either wild-type (WT) or catalytically inactive (KI) proteins. After 24 h, the cells were either left untreated, or exposed to 25 Gy of IR and harvested 1 h later. Cell lysates were analyzed by SDS-PAGE and immunoblot analysis with the α-pS-1423 antibody to detect Ser 1423-phosphorylated BRCA1. Expression levels of FLAG–ATR, FLAG–ATM, and FLAG–BRCA1 (1351–1552) were monitored by immunoblotting with α-FLAG, and are presented at top and bottom, respectively.

Journal:

Article Title: Functional interactions between BRCA1 and the checkpoint kinase ATR during genotoxic stress

doi:

Figure Lengend Snippet: Overexpression of wild-type ATR potentiates the phosphorylation of BRCA1 at Ser 1423 in intact cells. (A) Overexpression of FLAG–ATRWT stimulates the HU-induced phosphorylation of Ser 1423 in HEK 293T cells. HEK 293T cells were transfected with an expression vector encoding AU1-BRCA1–ΔN together with empty expression vector (−) or plasmids encoding FLAG–ATRWT, or FLAG–ATRKI. After 24 h, the transfected cells were left untreated or exposed to 2 mM HU, and harvested 1 h later. Cellular extracts were separated by SDS-PAGE and subjected to immunoblot analysis with the α-pS-1423 antibody to detect Ser 1423-phosphorylated BRCA1. Immunoblotting with α-FLAG or α-AU1 antibodies was performed to monitor expression levels of the FLAG–ATR and AU1-BRCA1–ΔN constructs, respectively. α-, β-, and γ-phosphorylated forms of AU1-BRCA1–ΔN are marked. (B) Overexpression of FLAG–ATRWT stimulates UV light-induced phosphorylation of Ser 1423 in HEK 293T cells. The experiment was performed as described in A, except that the transfected HEK 293T cells were exposed to 50 J/m2 UV light, and then harvested 1 h later. Cell lysates were subjected to SDS-PAGE and immunoblot analysis with the indicated antibodies. (C) Relative contributions of ATM and ATR to the IR-induced phosphorylation of BRCA1 on Ser 1423. HEK 293T cells were cotransfected with expression plasmids encoding FLAG-tagged BRCA1 (1351–1552) together with an empty expression vector (−), FLAG–ATR, or FLAG–ATM plasmids. The FLAG–ATR and FLAG–ATM expression constructs encoded either wild-type (WT) or catalytically inactive (KI) proteins. After 24 h, the cells were either left untreated, or exposed to 25 Gy of IR and harvested 1 h later. Cell lysates were analyzed by SDS-PAGE and immunoblot analysis with the α-pS-1423 antibody to detect Ser 1423-phosphorylated BRCA1. Expression levels of FLAG–ATR, FLAG–ATM, and FLAG–BRCA1 (1351–1552) were monitored by immunoblotting with α-FLAG, and are presented at top and bottom, respectively.

Article Snippet: Antibodies specific for ATR (Ab-1) and BRCA1 (Ab-1, Ab-2) were purchased from Oncogene Science.

Techniques: Over Expression, Transfection, Expressing, Plasmid Preparation, SDS Page, Western Blot, Construct

Overexpression of catalytically inactive ATR inhibits the DNA damage-induced phosphorylation of BRCA1 on Ser 1423. (A) Inhibition of HU- and UV-induced Ser 1423 phosphorylation. GM847/ATRKI cells were cultured either in the absence (−) or presence (+) of Dox for 96 h to induce ATRKI. Cells were then either left untreated or exposed to 2 mM HU for 4 h, or harvested 1 h after exposure to 200 J/m2 UV light. Cell lysates were prepared and immunoblots were performed with the indicated antibodies. Autoradiograms were quantitated by densitometry and phospho-Ser 1423 levels were normalized to account for differences in total BRCA1 protein levels. (B) Time course of Ser 1423 phosphorylation in response to IR. GM847/ATRKI cells were cultured in the presence of Dox for 96 h and then left untreated or exposed to 20 Gy of IR and harvested at the indicated times. Analysis of Ser 1423-phosphorylated BRCA1 were determined as described in A.

Journal:

Article Title: Functional interactions between BRCA1 and the checkpoint kinase ATR during genotoxic stress

doi:

Figure Lengend Snippet: Overexpression of catalytically inactive ATR inhibits the DNA damage-induced phosphorylation of BRCA1 on Ser 1423. (A) Inhibition of HU- and UV-induced Ser 1423 phosphorylation. GM847/ATRKI cells were cultured either in the absence (−) or presence (+) of Dox for 96 h to induce ATRKI. Cells were then either left untreated or exposed to 2 mM HU for 4 h, or harvested 1 h after exposure to 200 J/m2 UV light. Cell lysates were prepared and immunoblots were performed with the indicated antibodies. Autoradiograms were quantitated by densitometry and phospho-Ser 1423 levels were normalized to account for differences in total BRCA1 protein levels. (B) Time course of Ser 1423 phosphorylation in response to IR. GM847/ATRKI cells were cultured in the presence of Dox for 96 h and then left untreated or exposed to 20 Gy of IR and harvested at the indicated times. Analysis of Ser 1423-phosphorylated BRCA1 were determined as described in A.

Article Snippet: Antibodies specific for ATR (Ab-1) and BRCA1 (Ab-1, Ab-2) were purchased from Oncogene Science.

Techniques: Over Expression, Inhibition, Cell Culture, Western Blot

Colocalization of ATR and BRCA1 in APH-induced nuclear foci. HEK 293T cells were transfected with a GFP–ATR expression vector and then either left untreated (A), or cultured in the presence of APH for 24 h (B). Cells were then fixed, permeabilized, and immunostained with a BRCA1-specific monoclonal antibody. Foci that contain both ATR and BRCA1 appear yellow or orange in the merged image. (C) Colocalization of endogenous ATR and BRCA1 in K562 cells. K562 cells were treated with APH for 24 h, and then were fixed and immunostained with α-ATR and α-BRCA1 antibodies. Typical foci that demonstrate colocalization of ATR and BRCA1 are indicated by arrows.

Journal:

Article Title: Functional interactions between BRCA1 and the checkpoint kinase ATR during genotoxic stress

doi:

Figure Lengend Snippet: Colocalization of ATR and BRCA1 in APH-induced nuclear foci. HEK 293T cells were transfected with a GFP–ATR expression vector and then either left untreated (A), or cultured in the presence of APH for 24 h (B). Cells were then fixed, permeabilized, and immunostained with a BRCA1-specific monoclonal antibody. Foci that contain both ATR and BRCA1 appear yellow or orange in the merged image. (C) Colocalization of endogenous ATR and BRCA1 in K562 cells. K562 cells were treated with APH for 24 h, and then were fixed and immunostained with α-ATR and α-BRCA1 antibodies. Typical foci that demonstrate colocalization of ATR and BRCA1 are indicated by arrows.

Article Snippet: Antibodies specific for ATR (Ab-1) and BRCA1 (Ab-1, Ab-2) were purchased from Oncogene Science.

Techniques: Transfection, Expressing, Plasmid Preparation, Cell Culture

Journal: iScience

Article Title: A host lipase prevents lipopolysaccharide-induced foam cell formation

doi: 10.1016/j.isci.2021.103004

Figure Lengend Snippet:

Article Snippet: Then the donor and recipient macrophages were separated by using anti-CD45.1 Ab-PerCP-Cy5.5 (Clone A20, BD) or anti-CD45.2 Ab-APC (Clone 104, BD) and the frequency of donor and recipient macrophages was obtained.

Techniques: Recombinant, Western Blot, Acid Assay, Cell Viability Assay, Enzyme-linked Immunosorbent Assay, Isolation, SYBR Green Assay, Microarray, Software